Review



78c  (MedChemExpress)


Bioz Verified Symbol MedChemExpress is a verified supplier
Bioz Manufacturer Symbol MedChemExpress manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    MedChemExpress 78c
    In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and <t>78c)</t> over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.
    78c, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd38+inhibitor+1/CD38+inhibitor+1/pmc13233800-43-0-2
    Average 94 stars, based on 12 article reviews
    78c - by Bioz Stars, 2026-09
    94/100 stars

    Images

    1) Product Images from "Structural dissection of CD38 antigen engagement by CAR binders and rational affinity tuning"

    Article Title: Structural dissection of CD38 antigen engagement by CAR binders and rational affinity tuning

    Journal: iScience

    doi: 10.1016/j.isci.2026.115937

    In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and 78c) over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.
    Figure Legend Snippet: In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and 78c) over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.

    Techniques Used: In Vitro, Inhibition, Activity Assay, Negative Control, Generated, Concentration Assay, Fluorescence

    Related Articles

    Cell Culture:

    Article Title: CD38 + CD39 + NK cells associate with HIV disease progression and negatively regulate T cell proliferation
    Article Snippet: NK, CD4+ T, and CD8+ T cells were collected using negative isolation kits (Stemcell, CAN). .. The NK cells were cultured with a CD38 inhibitor 1 (78c, 0.5 μM, MCE, USA), ARL67156 trisodium salt (100 μM, MCE, USA), AB-680 (100 nM, MCE, USA), and EHNA hydrochloride (100 μM, MCE,USA) for 30 mins. .. CD4+ T and CD8+ T cells were stained using CellTrace Violet (Invitrogen, USA) for 30 mins.

    Quantitation Assay:

    Article Title: NAD+ Metabolism Maintains Inducible PD-L1 Expression to Drive Tumor Immune Evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Selisistat MCE Cat#HY-15452 Olaparib Selleck Cat#S1060 CD38 inhibitor 1 (compound 78c) MCE Cat#HY-123999 Decitabine Selleck Cat#S1200 N-Acetyl-L-cysteine (NAC) Sigma-Aldrich Cat#A9165 a-Ketoglutarate (a-KG) Sigma-Aldrich Cat#75890 2-Hydroxyglutarate (2-HG) Selleck Cat#S7873 Cycloheximide (CHX) MCE Cat#HY-12320 Puromycin ApexBio Cat#B7587 Critical Commercial Assays NAD+/NADH Quantitation Kit Abcam Cat#ab65348 Epigenase 5mC Hydroxylase TET Activity/ Inhibition Assay Kit Epigentek Cat#P-3087 EpiQuik Nuclear Extraction Kit Epigentek Cat#OP-0002 EpiQuik Chromatin Immunoprecipitation (ChIP) Kit Epigentek Cat#P-2002 Experimental Models: Cell Lines Mouse Hepa1-6 CBTCCCAS Cat#SCSP-512 Mouse LLC CBTCCCAS Cat#TCM 7 Human Huh7 CBTCCCAS Cat#SCSP-526 Mouse B16 CBTCCCAS Cat#TCM 2 Mouse Pan02 Cell Resource Center, IBMS, CAMS/PUMC Cat#3111C0001CCC000446 Experimental Models: Organisms/Strains Mouse: C57BL/6 Chinese Academy of Sciences N/A Nude Mice Chinese Academy of Sciences N/A Oligonucleotides shRNA targeting sequence: Nampt #1: GCAAGAGACTGCTGGCATA; Nampt #2: GAACTACATCCTTGAGAAA This paper N/A shRNA targeting sequence: PD-L1 (Cd274): GGATATTTGCTGGCATTAT This paper N/A CRISPR/Cas9 targeting sequence: Nampt #1: CAGAGGAGTCTCTTCGCAAG; Nampt #2: TGTGAACAGCACGTTCCCTC This paper N/A Primers for real-time PCR, see Table S1 This paper N/A Recombinant DNA pCMV-HA-Tet1-1-565 (Wang et al., 2017) N/A pCMV-HA-Tet1-1-610 (Wang et al., 2017) N/A pCMV-HA-Tet1-609-1525 (Wang et al., 2017) N/A pCMV-HA-Tet1-1525-2039 (Wang et al., 2017) N/A pGAG-Tet1 (Wang et al., 2017) N/A Tet1 catalytic domain mutant (Tet1-mCD) (Wang et al., 2017) N/A Tet1 catalytic domain (Tet1-CD) (Wang et al., 2017) N/A Software and Algorithms FlowJo 7.6 BD Biosciences https://www.flowjo.com/ Prism 6 GraphPad https://www.graphpad.com/ LinkedOmics (Vasaikar et al., 2018) http://www.linkedomics.org/ R2: Genomics Analysis and Visualization Platform Jan Koster https://hgserver1.amc.nl/cgi-bin/r2/main.cgi MethHC (Huang et al., 2015) http://methhc.mbc.nctu.edu.tw/ Kaplan-Meier Plotter (KM-Plotter) (Menyhárt et al., 2018) http://kmplot.com/analysis/ (Continued on next page) e2 Cell Metabolism 33, 1–18.e1–e5, January 5, 2021

    Activity Assay:

    Article Title: NAD+ Metabolism Maintains Inducible PD-L1 Expression to Drive Tumor Immune Evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Selisistat MCE Cat#HY-15452 Olaparib Selleck Cat#S1060 CD38 inhibitor 1 (compound 78c) MCE Cat#HY-123999 Decitabine Selleck Cat#S1200 N-Acetyl-L-cysteine (NAC) Sigma-Aldrich Cat#A9165 a-Ketoglutarate (a-KG) Sigma-Aldrich Cat#75890 2-Hydroxyglutarate (2-HG) Selleck Cat#S7873 Cycloheximide (CHX) MCE Cat#HY-12320 Puromycin ApexBio Cat#B7587 Critical Commercial Assays NAD+/NADH Quantitation Kit Abcam Cat#ab65348 Epigenase 5mC Hydroxylase TET Activity/ Inhibition Assay Kit Epigentek Cat#P-3087 EpiQuik Nuclear Extraction Kit Epigentek Cat#OP-0002 EpiQuik Chromatin Immunoprecipitation (ChIP) Kit Epigentek Cat#P-2002 Experimental Models: Cell Lines Mouse Hepa1-6 CBTCCCAS Cat#SCSP-512 Mouse LLC CBTCCCAS Cat#TCM 7 Human Huh7 CBTCCCAS Cat#SCSP-526 Mouse B16 CBTCCCAS Cat#TCM 2 Mouse Pan02 Cell Resource Center, IBMS, CAMS/PUMC Cat#3111C0001CCC000446 Experimental Models: Organisms/Strains Mouse: C57BL/6 Chinese Academy of Sciences N/A Nude Mice Chinese Academy of Sciences N/A Oligonucleotides shRNA targeting sequence: Nampt #1: GCAAGAGACTGCTGGCATA; Nampt #2: GAACTACATCCTTGAGAAA This paper N/A shRNA targeting sequence: PD-L1 (Cd274): GGATATTTGCTGGCATTAT This paper N/A CRISPR/Cas9 targeting sequence: Nampt #1: CAGAGGAGTCTCTTCGCAAG; Nampt #2: TGTGAACAGCACGTTCCCTC This paper N/A Primers for real-time PCR, see Table S1 This paper N/A Recombinant DNA pCMV-HA-Tet1-1-565 (Wang et al., 2017) N/A pCMV-HA-Tet1-1-610 (Wang et al., 2017) N/A pCMV-HA-Tet1-609-1525 (Wang et al., 2017) N/A pCMV-HA-Tet1-1525-2039 (Wang et al., 2017) N/A pGAG-Tet1 (Wang et al., 2017) N/A Tet1 catalytic domain mutant (Tet1-mCD) (Wang et al., 2017) N/A Tet1 catalytic domain (Tet1-CD) (Wang et al., 2017) N/A Software and Algorithms FlowJo 7.6 BD Biosciences https://www.flowjo.com/ Prism 6 GraphPad https://www.graphpad.com/ LinkedOmics (Vasaikar et al., 2018) http://www.linkedomics.org/ R2: Genomics Analysis and Visualization Platform Jan Koster https://hgserver1.amc.nl/cgi-bin/r2/main.cgi MethHC (Huang et al., 2015) http://methhc.mbc.nctu.edu.tw/ Kaplan-Meier Plotter (KM-Plotter) (Menyhárt et al., 2018) http://kmplot.com/analysis/ (Continued on next page) e2 Cell Metabolism 33, 1–18.e1–e5, January 5, 2021

    Inhibition:

    Article Title: NAD+ Metabolism Maintains Inducible PD-L1 Expression to Drive Tumor Immune Evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Selisistat MCE Cat#HY-15452 Olaparib Selleck Cat#S1060 CD38 inhibitor 1 (compound 78c) MCE Cat#HY-123999 Decitabine Selleck Cat#S1200 N-Acetyl-L-cysteine (NAC) Sigma-Aldrich Cat#A9165 a-Ketoglutarate (a-KG) Sigma-Aldrich Cat#75890 2-Hydroxyglutarate (2-HG) Selleck Cat#S7873 Cycloheximide (CHX) MCE Cat#HY-12320 Puromycin ApexBio Cat#B7587 Critical Commercial Assays NAD+/NADH Quantitation Kit Abcam Cat#ab65348 Epigenase 5mC Hydroxylase TET Activity/ Inhibition Assay Kit Epigentek Cat#P-3087 EpiQuik Nuclear Extraction Kit Epigentek Cat#OP-0002 EpiQuik Chromatin Immunoprecipitation (ChIP) Kit Epigentek Cat#P-2002 Experimental Models: Cell Lines Mouse Hepa1-6 CBTCCCAS Cat#SCSP-512 Mouse LLC CBTCCCAS Cat#TCM 7 Human Huh7 CBTCCCAS Cat#SCSP-526 Mouse B16 CBTCCCAS Cat#TCM 2 Mouse Pan02 Cell Resource Center, IBMS, CAMS/PUMC Cat#3111C0001CCC000446 Experimental Models: Organisms/Strains Mouse: C57BL/6 Chinese Academy of Sciences N/A Nude Mice Chinese Academy of Sciences N/A Oligonucleotides shRNA targeting sequence: Nampt #1: GCAAGAGACTGCTGGCATA; Nampt #2: GAACTACATCCTTGAGAAA This paper N/A shRNA targeting sequence: PD-L1 (Cd274): GGATATTTGCTGGCATTAT This paper N/A CRISPR/Cas9 targeting sequence: Nampt #1: CAGAGGAGTCTCTTCGCAAG; Nampt #2: TGTGAACAGCACGTTCCCTC This paper N/A Primers for real-time PCR, see Table S1 This paper N/A Recombinant DNA pCMV-HA-Tet1-1-565 (Wang et al., 2017) N/A pCMV-HA-Tet1-1-610 (Wang et al., 2017) N/A pCMV-HA-Tet1-609-1525 (Wang et al., 2017) N/A pCMV-HA-Tet1-1525-2039 (Wang et al., 2017) N/A pGAG-Tet1 (Wang et al., 2017) N/A Tet1 catalytic domain mutant (Tet1-mCD) (Wang et al., 2017) N/A Tet1 catalytic domain (Tet1-CD) (Wang et al., 2017) N/A Software and Algorithms FlowJo 7.6 BD Biosciences https://www.flowjo.com/ Prism 6 GraphPad https://www.graphpad.com/ LinkedOmics (Vasaikar et al., 2018) http://www.linkedomics.org/ R2: Genomics Analysis and Visualization Platform Jan Koster https://hgserver1.amc.nl/cgi-bin/r2/main.cgi MethHC (Huang et al., 2015) http://methhc.mbc.nctu.edu.tw/ Kaplan-Meier Plotter (KM-Plotter) (Menyhárt et al., 2018) http://kmplot.com/analysis/ (Continued on next page) e2 Cell Metabolism 33, 1–18.e1–e5, January 5, 2021

    Extraction:

    Article Title: NAD+ Metabolism Maintains Inducible PD-L1 Expression to Drive Tumor Immune Evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Selisistat MCE Cat#HY-15452 Olaparib Selleck Cat#S1060 CD38 inhibitor 1 (compound 78c) MCE Cat#HY-123999 Decitabine Selleck Cat#S1200 N-Acetyl-L-cysteine (NAC) Sigma-Aldrich Cat#A9165 a-Ketoglutarate (a-KG) Sigma-Aldrich Cat#75890 2-Hydroxyglutarate (2-HG) Selleck Cat#S7873 Cycloheximide (CHX) MCE Cat#HY-12320 Puromycin ApexBio Cat#B7587 Critical Commercial Assays NAD+/NADH Quantitation Kit Abcam Cat#ab65348 Epigenase 5mC Hydroxylase TET Activity/ Inhibition Assay Kit Epigentek Cat#P-3087 EpiQuik Nuclear Extraction Kit Epigentek Cat#OP-0002 EpiQuik Chromatin Immunoprecipitation (ChIP) Kit Epigentek Cat#P-2002 Experimental Models: Cell Lines Mouse Hepa1-6 CBTCCCAS Cat#SCSP-512 Mouse LLC CBTCCCAS Cat#TCM 7 Human Huh7 CBTCCCAS Cat#SCSP-526 Mouse B16 CBTCCCAS Cat#TCM 2 Mouse Pan02 Cell Resource Center, IBMS, CAMS/PUMC Cat#3111C0001CCC000446 Experimental Models: Organisms/Strains Mouse: C57BL/6 Chinese Academy of Sciences N/A Nude Mice Chinese Academy of Sciences N/A Oligonucleotides shRNA targeting sequence: Nampt #1: GCAAGAGACTGCTGGCATA; Nampt #2: GAACTACATCCTTGAGAAA This paper N/A shRNA targeting sequence: PD-L1 (Cd274): GGATATTTGCTGGCATTAT This paper N/A CRISPR/Cas9 targeting sequence: Nampt #1: CAGAGGAGTCTCTTCGCAAG; Nampt #2: TGTGAACAGCACGTTCCCTC This paper N/A Primers for real-time PCR, see Table S1 This paper N/A Recombinant DNA pCMV-HA-Tet1-1-565 (Wang et al., 2017) N/A pCMV-HA-Tet1-1-610 (Wang et al., 2017) N/A pCMV-HA-Tet1-609-1525 (Wang et al., 2017) N/A pCMV-HA-Tet1-1525-2039 (Wang et al., 2017) N/A pGAG-Tet1 (Wang et al., 2017) N/A Tet1 catalytic domain mutant (Tet1-mCD) (Wang et al., 2017) N/A Tet1 catalytic domain (Tet1-CD) (Wang et al., 2017) N/A Software and Algorithms FlowJo 7.6 BD Biosciences https://www.flowjo.com/ Prism 6 GraphPad https://www.graphpad.com/ LinkedOmics (Vasaikar et al., 2018) http://www.linkedomics.org/ R2: Genomics Analysis and Visualization Platform Jan Koster https://hgserver1.amc.nl/cgi-bin/r2/main.cgi MethHC (Huang et al., 2015) http://methhc.mbc.nctu.edu.tw/ Kaplan-Meier Plotter (KM-Plotter) (Menyhárt et al., 2018) http://kmplot.com/analysis/ (Continued on next page) e2 Cell Metabolism 33, 1–18.e1–e5, January 5, 2021

    Chromatin Immunoprecipitation:

    Article Title: NAD+ Metabolism Maintains Inducible PD-L1 Expression to Drive Tumor Immune Evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Selisistat MCE Cat#HY-15452 Olaparib Selleck Cat#S1060 CD38 inhibitor 1 (compound 78c) MCE Cat#HY-123999 Decitabine Selleck Cat#S1200 N-Acetyl-L-cysteine (NAC) Sigma-Aldrich Cat#A9165 a-Ketoglutarate (a-KG) Sigma-Aldrich Cat#75890 2-Hydroxyglutarate (2-HG) Selleck Cat#S7873 Cycloheximide (CHX) MCE Cat#HY-12320 Puromycin ApexBio Cat#B7587 Critical Commercial Assays NAD+/NADH Quantitation Kit Abcam Cat#ab65348 Epigenase 5mC Hydroxylase TET Activity/ Inhibition Assay Kit Epigentek Cat#P-3087 EpiQuik Nuclear Extraction Kit Epigentek Cat#OP-0002 EpiQuik Chromatin Immunoprecipitation (ChIP) Kit Epigentek Cat#P-2002 Experimental Models: Cell Lines Mouse Hepa1-6 CBTCCCAS Cat#SCSP-512 Mouse LLC CBTCCCAS Cat#TCM 7 Human Huh7 CBTCCCAS Cat#SCSP-526 Mouse B16 CBTCCCAS Cat#TCM 2 Mouse Pan02 Cell Resource Center, IBMS, CAMS/PUMC Cat#3111C0001CCC000446 Experimental Models: Organisms/Strains Mouse: C57BL/6 Chinese Academy of Sciences N/A Nude Mice Chinese Academy of Sciences N/A Oligonucleotides shRNA targeting sequence: Nampt #1: GCAAGAGACTGCTGGCATA; Nampt #2: GAACTACATCCTTGAGAAA This paper N/A shRNA targeting sequence: PD-L1 (Cd274): GGATATTTGCTGGCATTAT This paper N/A CRISPR/Cas9 targeting sequence: Nampt #1: CAGAGGAGTCTCTTCGCAAG; Nampt #2: TGTGAACAGCACGTTCCCTC This paper N/A Primers for real-time PCR, see Table S1 This paper N/A Recombinant DNA pCMV-HA-Tet1-1-565 (Wang et al., 2017) N/A pCMV-HA-Tet1-1-610 (Wang et al., 2017) N/A pCMV-HA-Tet1-609-1525 (Wang et al., 2017) N/A pCMV-HA-Tet1-1525-2039 (Wang et al., 2017) N/A pGAG-Tet1 (Wang et al., 2017) N/A Tet1 catalytic domain mutant (Tet1-mCD) (Wang et al., 2017) N/A Tet1 catalytic domain (Tet1-CD) (Wang et al., 2017) N/A Software and Algorithms FlowJo 7.6 BD Biosciences https://www.flowjo.com/ Prism 6 GraphPad https://www.graphpad.com/ LinkedOmics (Vasaikar et al., 2018) http://www.linkedomics.org/ R2: Genomics Analysis and Visualization Platform Jan Koster https://hgserver1.amc.nl/cgi-bin/r2/main.cgi MethHC (Huang et al., 2015) http://methhc.mbc.nctu.edu.tw/ Kaplan-Meier Plotter (KM-Plotter) (Menyhárt et al., 2018) http://kmplot.com/analysis/ (Continued on next page) e2 Cell Metabolism 33, 1–18.e1–e5, January 5, 2021

    Mouse Assay:

    Article Title: NAD+ Metabolism Maintains Inducible PD-L1 Expression to Drive Tumor Immune Evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Selisistat MCE Cat#HY-15452 Olaparib Selleck Cat#S1060 CD38 inhibitor 1 (compound 78c) MCE Cat#HY-123999 Decitabine Selleck Cat#S1200 N-Acetyl-L-cysteine (NAC) Sigma-Aldrich Cat#A9165 a-Ketoglutarate (a-KG) Sigma-Aldrich Cat#75890 2-Hydroxyglutarate (2-HG) Selleck Cat#S7873 Cycloheximide (CHX) MCE Cat#HY-12320 Puromycin ApexBio Cat#B7587 Critical Commercial Assays NAD+/NADH Quantitation Kit Abcam Cat#ab65348 Epigenase 5mC Hydroxylase TET Activity/ Inhibition Assay Kit Epigentek Cat#P-3087 EpiQuik Nuclear Extraction Kit Epigentek Cat#OP-0002 EpiQuik Chromatin Immunoprecipitation (ChIP) Kit Epigentek Cat#P-2002 Experimental Models: Cell Lines Mouse Hepa1-6 CBTCCCAS Cat#SCSP-512 Mouse LLC CBTCCCAS Cat#TCM 7 Human Huh7 CBTCCCAS Cat#SCSP-526 Mouse B16 CBTCCCAS Cat#TCM 2 Mouse Pan02 Cell Resource Center, IBMS, CAMS/PUMC Cat#3111C0001CCC000446 Experimental Models: Organisms/Strains Mouse: C57BL/6 Chinese Academy of Sciences N/A Nude Mice Chinese Academy of Sciences N/A Oligonucleotides shRNA targeting sequence: Nampt #1: GCAAGAGACTGCTGGCATA; Nampt #2: GAACTACATCCTTGAGAAA This paper N/A shRNA targeting sequence: PD-L1 (Cd274): GGATATTTGCTGGCATTAT This paper N/A CRISPR/Cas9 targeting sequence: Nampt #1: CAGAGGAGTCTCTTCGCAAG; Nampt #2: TGTGAACAGCACGTTCCCTC This paper N/A Primers for real-time PCR, see Table S1 This paper N/A Recombinant DNA pCMV-HA-Tet1-1-565 (Wang et al., 2017) N/A pCMV-HA-Tet1-1-610 (Wang et al., 2017) N/A pCMV-HA-Tet1-609-1525 (Wang et al., 2017) N/A pCMV-HA-Tet1-1525-2039 (Wang et al., 2017) N/A pGAG-Tet1 (Wang et al., 2017) N/A Tet1 catalytic domain mutant (Tet1-mCD) (Wang et al., 2017) N/A Tet1 catalytic domain (Tet1-CD) (Wang et al., 2017) N/A Software and Algorithms FlowJo 7.6 BD Biosciences https://www.flowjo.com/ Prism 6 GraphPad https://www.graphpad.com/ LinkedOmics (Vasaikar et al., 2018) http://www.linkedomics.org/ R2: Genomics Analysis and Visualization Platform Jan Koster https://hgserver1.amc.nl/cgi-bin/r2/main.cgi MethHC (Huang et al., 2015) http://methhc.mbc.nctu.edu.tw/ Kaplan-Meier Plotter (KM-Plotter) (Menyhárt et al., 2018) http://kmplot.com/analysis/ (Continued on next page) e2 Cell Metabolism 33, 1–18.e1–e5, January 5, 2021

    shRNA:

    Article Title: NAD+ Metabolism Maintains Inducible PD-L1 Expression to Drive Tumor Immune Evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Selisistat MCE Cat#HY-15452 Olaparib Selleck Cat#S1060 CD38 inhibitor 1 (compound 78c) MCE Cat#HY-123999 Decitabine Selleck Cat#S1200 N-Acetyl-L-cysteine (NAC) Sigma-Aldrich Cat#A9165 a-Ketoglutarate (a-KG) Sigma-Aldrich Cat#75890 2-Hydroxyglutarate (2-HG) Selleck Cat#S7873 Cycloheximide (CHX) MCE Cat#HY-12320 Puromycin ApexBio Cat#B7587 Critical Commercial Assays NAD+/NADH Quantitation Kit Abcam Cat#ab65348 Epigenase 5mC Hydroxylase TET Activity/ Inhibition Assay Kit Epigentek Cat#P-3087 EpiQuik Nuclear Extraction Kit Epigentek Cat#OP-0002 EpiQuik Chromatin Immunoprecipitation (ChIP) Kit Epigentek Cat#P-2002 Experimental Models: Cell Lines Mouse Hepa1-6 CBTCCCAS Cat#SCSP-512 Mouse LLC CBTCCCAS Cat#TCM 7 Human Huh7 CBTCCCAS Cat#SCSP-526 Mouse B16 CBTCCCAS Cat#TCM 2 Mouse Pan02 Cell Resource Center, IBMS, CAMS/PUMC Cat#3111C0001CCC000446 Experimental Models: Organisms/Strains Mouse: C57BL/6 Chinese Academy of Sciences N/A Nude Mice Chinese Academy of Sciences N/A Oligonucleotides shRNA targeting sequence: Nampt #1: GCAAGAGACTGCTGGCATA; Nampt #2: GAACTACATCCTTGAGAAA This paper N/A shRNA targeting sequence: PD-L1 (Cd274): GGATATTTGCTGGCATTAT This paper N/A CRISPR/Cas9 targeting sequence: Nampt #1: CAGAGGAGTCTCTTCGCAAG; Nampt #2: TGTGAACAGCACGTTCCCTC This paper N/A Primers for real-time PCR, see Table S1 This paper N/A Recombinant DNA pCMV-HA-Tet1-1-565 (Wang et al., 2017) N/A pCMV-HA-Tet1-1-610 (Wang et al., 2017) N/A pCMV-HA-Tet1-609-1525 (Wang et al., 2017) N/A pCMV-HA-Tet1-1525-2039 (Wang et al., 2017) N/A pGAG-Tet1 (Wang et al., 2017) N/A Tet1 catalytic domain mutant (Tet1-mCD) (Wang et al., 2017) N/A Tet1 catalytic domain (Tet1-CD) (Wang et al., 2017) N/A Software and Algorithms FlowJo 7.6 BD Biosciences https://www.flowjo.com/ Prism 6 GraphPad https://www.graphpad.com/ LinkedOmics (Vasaikar et al., 2018) http://www.linkedomics.org/ R2: Genomics Analysis and Visualization Platform Jan Koster https://hgserver1.amc.nl/cgi-bin/r2/main.cgi MethHC (Huang et al., 2015) http://methhc.mbc.nctu.edu.tw/ Kaplan-Meier Plotter (KM-Plotter) (Menyhárt et al., 2018) http://kmplot.com/analysis/ (Continued on next page) e2 Cell Metabolism 33, 1–18.e1–e5, January 5, 2021

    Sequencing:

    Article Title: NAD+ Metabolism Maintains Inducible PD-L1 Expression to Drive Tumor Immune Evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Selisistat MCE Cat#HY-15452 Olaparib Selleck Cat#S1060 CD38 inhibitor 1 (compound 78c) MCE Cat#HY-123999 Decitabine Selleck Cat#S1200 N-Acetyl-L-cysteine (NAC) Sigma-Aldrich Cat#A9165 a-Ketoglutarate (a-KG) Sigma-Aldrich Cat#75890 2-Hydroxyglutarate (2-HG) Selleck Cat#S7873 Cycloheximide (CHX) MCE Cat#HY-12320 Puromycin ApexBio Cat#B7587 Critical Commercial Assays NAD+/NADH Quantitation Kit Abcam Cat#ab65348 Epigenase 5mC Hydroxylase TET Activity/ Inhibition Assay Kit Epigentek Cat#P-3087 EpiQuik Nuclear Extraction Kit Epigentek Cat#OP-0002 EpiQuik Chromatin Immunoprecipitation (ChIP) Kit Epigentek Cat#P-2002 Experimental Models: Cell Lines Mouse Hepa1-6 CBTCCCAS Cat#SCSP-512 Mouse LLC CBTCCCAS Cat#TCM 7 Human Huh7 CBTCCCAS Cat#SCSP-526 Mouse B16 CBTCCCAS Cat#TCM 2 Mouse Pan02 Cell Resource Center, IBMS, CAMS/PUMC Cat#3111C0001CCC000446 Experimental Models: Organisms/Strains Mouse: C57BL/6 Chinese Academy of Sciences N/A Nude Mice Chinese Academy of Sciences N/A Oligonucleotides shRNA targeting sequence: Nampt #1: GCAAGAGACTGCTGGCATA; Nampt #2: GAACTACATCCTTGAGAAA This paper N/A shRNA targeting sequence: PD-L1 (Cd274): GGATATTTGCTGGCATTAT This paper N/A CRISPR/Cas9 targeting sequence: Nampt #1: CAGAGGAGTCTCTTCGCAAG; Nampt #2: TGTGAACAGCACGTTCCCTC This paper N/A Primers for real-time PCR, see Table S1 This paper N/A Recombinant DNA pCMV-HA-Tet1-1-565 (Wang et al., 2017) N/A pCMV-HA-Tet1-1-610 (Wang et al., 2017) N/A pCMV-HA-Tet1-609-1525 (Wang et al., 2017) N/A pCMV-HA-Tet1-1525-2039 (Wang et al., 2017) N/A pGAG-Tet1 (Wang et al., 2017) N/A Tet1 catalytic domain mutant (Tet1-mCD) (Wang et al., 2017) N/A Tet1 catalytic domain (Tet1-CD) (Wang et al., 2017) N/A Software and Algorithms FlowJo 7.6 BD Biosciences https://www.flowjo.com/ Prism 6 GraphPad https://www.graphpad.com/ LinkedOmics (Vasaikar et al., 2018) http://www.linkedomics.org/ R2: Genomics Analysis and Visualization Platform Jan Koster https://hgserver1.amc.nl/cgi-bin/r2/main.cgi MethHC (Huang et al., 2015) http://methhc.mbc.nctu.edu.tw/ Kaplan-Meier Plotter (KM-Plotter) (Menyhárt et al., 2018) http://kmplot.com/analysis/ (Continued on next page) e2 Cell Metabolism 33, 1–18.e1–e5, January 5, 2021

    CRISPR:

    Article Title: NAD+ Metabolism Maintains Inducible PD-L1 Expression to Drive Tumor Immune Evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Selisistat MCE Cat#HY-15452 Olaparib Selleck Cat#S1060 CD38 inhibitor 1 (compound 78c) MCE Cat#HY-123999 Decitabine Selleck Cat#S1200 N-Acetyl-L-cysteine (NAC) Sigma-Aldrich Cat#A9165 a-Ketoglutarate (a-KG) Sigma-Aldrich Cat#75890 2-Hydroxyglutarate (2-HG) Selleck Cat#S7873 Cycloheximide (CHX) MCE Cat#HY-12320 Puromycin ApexBio Cat#B7587 Critical Commercial Assays NAD+/NADH Quantitation Kit Abcam Cat#ab65348 Epigenase 5mC Hydroxylase TET Activity/ Inhibition Assay Kit Epigentek Cat#P-3087 EpiQuik Nuclear Extraction Kit Epigentek Cat#OP-0002 EpiQuik Chromatin Immunoprecipitation (ChIP) Kit Epigentek Cat#P-2002 Experimental Models: Cell Lines Mouse Hepa1-6 CBTCCCAS Cat#SCSP-512 Mouse LLC CBTCCCAS Cat#TCM 7 Human Huh7 CBTCCCAS Cat#SCSP-526 Mouse B16 CBTCCCAS Cat#TCM 2 Mouse Pan02 Cell Resource Center, IBMS, CAMS/PUMC Cat#3111C0001CCC000446 Experimental Models: Organisms/Strains Mouse: C57BL/6 Chinese Academy of Sciences N/A Nude Mice Chinese Academy of Sciences N/A Oligonucleotides shRNA targeting sequence: Nampt #1: GCAAGAGACTGCTGGCATA; Nampt #2: GAACTACATCCTTGAGAAA This paper N/A shRNA targeting sequence: PD-L1 (Cd274): GGATATTTGCTGGCATTAT This paper N/A CRISPR/Cas9 targeting sequence: Nampt #1: CAGAGGAGTCTCTTCGCAAG; Nampt #2: TGTGAACAGCACGTTCCCTC This paper N/A Primers for real-time PCR, see Table S1 This paper N/A Recombinant DNA pCMV-HA-Tet1-1-565 (Wang et al., 2017) N/A pCMV-HA-Tet1-1-610 (Wang et al., 2017) N/A pCMV-HA-Tet1-609-1525 (Wang et al., 2017) N/A pCMV-HA-Tet1-1525-2039 (Wang et al., 2017) N/A pGAG-Tet1 (Wang et al., 2017) N/A Tet1 catalytic domain mutant (Tet1-mCD) (Wang et al., 2017) N/A Tet1 catalytic domain (Tet1-CD) (Wang et al., 2017) N/A Software and Algorithms FlowJo 7.6 BD Biosciences https://www.flowjo.com/ Prism 6 GraphPad https://www.graphpad.com/ LinkedOmics (Vasaikar et al., 2018) http://www.linkedomics.org/ R2: Genomics Analysis and Visualization Platform Jan Koster https://hgserver1.amc.nl/cgi-bin/r2/main.cgi MethHC (Huang et al., 2015) http://methhc.mbc.nctu.edu.tw/ Kaplan-Meier Plotter (KM-Plotter) (Menyhárt et al., 2018) http://kmplot.com/analysis/ (Continued on next page) e2 Cell Metabolism 33, 1–18.e1–e5, January 5, 2021

    Real-time Polymerase Chain Reaction:

    Article Title: NAD+ Metabolism Maintains Inducible PD-L1 Expression to Drive Tumor Immune Evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Selisistat MCE Cat#HY-15452 Olaparib Selleck Cat#S1060 CD38 inhibitor 1 (compound 78c) MCE Cat#HY-123999 Decitabine Selleck Cat#S1200 N-Acetyl-L-cysteine (NAC) Sigma-Aldrich Cat#A9165 a-Ketoglutarate (a-KG) Sigma-Aldrich Cat#75890 2-Hydroxyglutarate (2-HG) Selleck Cat#S7873 Cycloheximide (CHX) MCE Cat#HY-12320 Puromycin ApexBio Cat#B7587 Critical Commercial Assays NAD+/NADH Quantitation Kit Abcam Cat#ab65348 Epigenase 5mC Hydroxylase TET Activity/ Inhibition Assay Kit Epigentek Cat#P-3087 EpiQuik Nuclear Extraction Kit Epigentek Cat#OP-0002 EpiQuik Chromatin Immunoprecipitation (ChIP) Kit Epigentek Cat#P-2002 Experimental Models: Cell Lines Mouse Hepa1-6 CBTCCCAS Cat#SCSP-512 Mouse LLC CBTCCCAS Cat#TCM 7 Human Huh7 CBTCCCAS Cat#SCSP-526 Mouse B16 CBTCCCAS Cat#TCM 2 Mouse Pan02 Cell Resource Center, IBMS, CAMS/PUMC Cat#3111C0001CCC000446 Experimental Models: Organisms/Strains Mouse: C57BL/6 Chinese Academy of Sciences N/A Nude Mice Chinese Academy of Sciences N/A Oligonucleotides shRNA targeting sequence: Nampt #1: GCAAGAGACTGCTGGCATA; Nampt #2: GAACTACATCCTTGAGAAA This paper N/A shRNA targeting sequence: PD-L1 (Cd274): GGATATTTGCTGGCATTAT This paper N/A CRISPR/Cas9 targeting sequence: Nampt #1: CAGAGGAGTCTCTTCGCAAG; Nampt #2: TGTGAACAGCACGTTCCCTC This paper N/A Primers for real-time PCR, see Table S1 This paper N/A Recombinant DNA pCMV-HA-Tet1-1-565 (Wang et al., 2017) N/A pCMV-HA-Tet1-1-610 (Wang et al., 2017) N/A pCMV-HA-Tet1-609-1525 (Wang et al., 2017) N/A pCMV-HA-Tet1-1525-2039 (Wang et al., 2017) N/A pGAG-Tet1 (Wang et al., 2017) N/A Tet1 catalytic domain mutant (Tet1-mCD) (Wang et al., 2017) N/A Tet1 catalytic domain (Tet1-CD) (Wang et al., 2017) N/A Software and Algorithms FlowJo 7.6 BD Biosciences https://www.flowjo.com/ Prism 6 GraphPad https://www.graphpad.com/ LinkedOmics (Vasaikar et al., 2018) http://www.linkedomics.org/ R2: Genomics Analysis and Visualization Platform Jan Koster https://hgserver1.amc.nl/cgi-bin/r2/main.cgi MethHC (Huang et al., 2015) http://methhc.mbc.nctu.edu.tw/ Kaplan-Meier Plotter (KM-Plotter) (Menyhárt et al., 2018) http://kmplot.com/analysis/ (Continued on next page) e2 Cell Metabolism 33, 1–18.e1–e5, January 5, 2021

    Recombinant:

    Article Title: NAD+ Metabolism Maintains Inducible PD-L1 Expression to Drive Tumor Immune Evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Selisistat MCE Cat#HY-15452 Olaparib Selleck Cat#S1060 CD38 inhibitor 1 (compound 78c) MCE Cat#HY-123999 Decitabine Selleck Cat#S1200 N-Acetyl-L-cysteine (NAC) Sigma-Aldrich Cat#A9165 a-Ketoglutarate (a-KG) Sigma-Aldrich Cat#75890 2-Hydroxyglutarate (2-HG) Selleck Cat#S7873 Cycloheximide (CHX) MCE Cat#HY-12320 Puromycin ApexBio Cat#B7587 Critical Commercial Assays NAD+/NADH Quantitation Kit Abcam Cat#ab65348 Epigenase 5mC Hydroxylase TET Activity/ Inhibition Assay Kit Epigentek Cat#P-3087 EpiQuik Nuclear Extraction Kit Epigentek Cat#OP-0002 EpiQuik Chromatin Immunoprecipitation (ChIP) Kit Epigentek Cat#P-2002 Experimental Models: Cell Lines Mouse Hepa1-6 CBTCCCAS Cat#SCSP-512 Mouse LLC CBTCCCAS Cat#TCM 7 Human Huh7 CBTCCCAS Cat#SCSP-526 Mouse B16 CBTCCCAS Cat#TCM 2 Mouse Pan02 Cell Resource Center, IBMS, CAMS/PUMC Cat#3111C0001CCC000446 Experimental Models: Organisms/Strains Mouse: C57BL/6 Chinese Academy of Sciences N/A Nude Mice Chinese Academy of Sciences N/A Oligonucleotides shRNA targeting sequence: Nampt #1: GCAAGAGACTGCTGGCATA; Nampt #2: GAACTACATCCTTGAGAAA This paper N/A shRNA targeting sequence: PD-L1 (Cd274): GGATATTTGCTGGCATTAT This paper N/A CRISPR/Cas9 targeting sequence: Nampt #1: CAGAGGAGTCTCTTCGCAAG; Nampt #2: TGTGAACAGCACGTTCCCTC This paper N/A Primers for real-time PCR, see Table S1 This paper N/A Recombinant DNA pCMV-HA-Tet1-1-565 (Wang et al., 2017) N/A pCMV-HA-Tet1-1-610 (Wang et al., 2017) N/A pCMV-HA-Tet1-609-1525 (Wang et al., 2017) N/A pCMV-HA-Tet1-1525-2039 (Wang et al., 2017) N/A pGAG-Tet1 (Wang et al., 2017) N/A Tet1 catalytic domain mutant (Tet1-mCD) (Wang et al., 2017) N/A Tet1 catalytic domain (Tet1-CD) (Wang et al., 2017) N/A Software and Algorithms FlowJo 7.6 BD Biosciences https://www.flowjo.com/ Prism 6 GraphPad https://www.graphpad.com/ LinkedOmics (Vasaikar et al., 2018) http://www.linkedomics.org/ R2: Genomics Analysis and Visualization Platform Jan Koster https://hgserver1.amc.nl/cgi-bin/r2/main.cgi MethHC (Huang et al., 2015) http://methhc.mbc.nctu.edu.tw/ Kaplan-Meier Plotter (KM-Plotter) (Menyhárt et al., 2018) http://kmplot.com/analysis/ (Continued on next page) e2 Cell Metabolism 33, 1–18.e1–e5, January 5, 2021

    Mutagenesis:

    Article Title: NAD+ Metabolism Maintains Inducible PD-L1 Expression to Drive Tumor Immune Evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Selisistat MCE Cat#HY-15452 Olaparib Selleck Cat#S1060 CD38 inhibitor 1 (compound 78c) MCE Cat#HY-123999 Decitabine Selleck Cat#S1200 N-Acetyl-L-cysteine (NAC) Sigma-Aldrich Cat#A9165 a-Ketoglutarate (a-KG) Sigma-Aldrich Cat#75890 2-Hydroxyglutarate (2-HG) Selleck Cat#S7873 Cycloheximide (CHX) MCE Cat#HY-12320 Puromycin ApexBio Cat#B7587 Critical Commercial Assays NAD+/NADH Quantitation Kit Abcam Cat#ab65348 Epigenase 5mC Hydroxylase TET Activity/ Inhibition Assay Kit Epigentek Cat#P-3087 EpiQuik Nuclear Extraction Kit Epigentek Cat#OP-0002 EpiQuik Chromatin Immunoprecipitation (ChIP) Kit Epigentek Cat#P-2002 Experimental Models: Cell Lines Mouse Hepa1-6 CBTCCCAS Cat#SCSP-512 Mouse LLC CBTCCCAS Cat#TCM 7 Human Huh7 CBTCCCAS Cat#SCSP-526 Mouse B16 CBTCCCAS Cat#TCM 2 Mouse Pan02 Cell Resource Center, IBMS, CAMS/PUMC Cat#3111C0001CCC000446 Experimental Models: Organisms/Strains Mouse: C57BL/6 Chinese Academy of Sciences N/A Nude Mice Chinese Academy of Sciences N/A Oligonucleotides shRNA targeting sequence: Nampt #1: GCAAGAGACTGCTGGCATA; Nampt #2: GAACTACATCCTTGAGAAA This paper N/A shRNA targeting sequence: PD-L1 (Cd274): GGATATTTGCTGGCATTAT This paper N/A CRISPR/Cas9 targeting sequence: Nampt #1: CAGAGGAGTCTCTTCGCAAG; Nampt #2: TGTGAACAGCACGTTCCCTC This paper N/A Primers for real-time PCR, see Table S1 This paper N/A Recombinant DNA pCMV-HA-Tet1-1-565 (Wang et al., 2017) N/A pCMV-HA-Tet1-1-610 (Wang et al., 2017) N/A pCMV-HA-Tet1-609-1525 (Wang et al., 2017) N/A pCMV-HA-Tet1-1525-2039 (Wang et al., 2017) N/A pGAG-Tet1 (Wang et al., 2017) N/A Tet1 catalytic domain mutant (Tet1-mCD) (Wang et al., 2017) N/A Tet1 catalytic domain (Tet1-CD) (Wang et al., 2017) N/A Software and Algorithms FlowJo 7.6 BD Biosciences https://www.flowjo.com/ Prism 6 GraphPad https://www.graphpad.com/ LinkedOmics (Vasaikar et al., 2018) http://www.linkedomics.org/ R2: Genomics Analysis and Visualization Platform Jan Koster https://hgserver1.amc.nl/cgi-bin/r2/main.cgi MethHC (Huang et al., 2015) http://methhc.mbc.nctu.edu.tw/ Kaplan-Meier Plotter (KM-Plotter) (Menyhárt et al., 2018) http://kmplot.com/analysis/ (Continued on next page) e2 Cell Metabolism 33, 1–18.e1–e5, January 5, 2021

    Software:

    Article Title: NAD+ Metabolism Maintains Inducible PD-L1 Expression to Drive Tumor Immune Evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Selisistat MCE Cat#HY-15452 Olaparib Selleck Cat#S1060 CD38 inhibitor 1 (compound 78c) MCE Cat#HY-123999 Decitabine Selleck Cat#S1200 N-Acetyl-L-cysteine (NAC) Sigma-Aldrich Cat#A9165 a-Ketoglutarate (a-KG) Sigma-Aldrich Cat#75890 2-Hydroxyglutarate (2-HG) Selleck Cat#S7873 Cycloheximide (CHX) MCE Cat#HY-12320 Puromycin ApexBio Cat#B7587 Critical Commercial Assays NAD+/NADH Quantitation Kit Abcam Cat#ab65348 Epigenase 5mC Hydroxylase TET Activity/ Inhibition Assay Kit Epigentek Cat#P-3087 EpiQuik Nuclear Extraction Kit Epigentek Cat#OP-0002 EpiQuik Chromatin Immunoprecipitation (ChIP) Kit Epigentek Cat#P-2002 Experimental Models: Cell Lines Mouse Hepa1-6 CBTCCCAS Cat#SCSP-512 Mouse LLC CBTCCCAS Cat#TCM 7 Human Huh7 CBTCCCAS Cat#SCSP-526 Mouse B16 CBTCCCAS Cat#TCM 2 Mouse Pan02 Cell Resource Center, IBMS, CAMS/PUMC Cat#3111C0001CCC000446 Experimental Models: Organisms/Strains Mouse: C57BL/6 Chinese Academy of Sciences N/A Nude Mice Chinese Academy of Sciences N/A Oligonucleotides shRNA targeting sequence: Nampt #1: GCAAGAGACTGCTGGCATA; Nampt #2: GAACTACATCCTTGAGAAA This paper N/A shRNA targeting sequence: PD-L1 (Cd274): GGATATTTGCTGGCATTAT This paper N/A CRISPR/Cas9 targeting sequence: Nampt #1: CAGAGGAGTCTCTTCGCAAG; Nampt #2: TGTGAACAGCACGTTCCCTC This paper N/A Primers for real-time PCR, see Table S1 This paper N/A Recombinant DNA pCMV-HA-Tet1-1-565 (Wang et al., 2017) N/A pCMV-HA-Tet1-1-610 (Wang et al., 2017) N/A pCMV-HA-Tet1-609-1525 (Wang et al., 2017) N/A pCMV-HA-Tet1-1525-2039 (Wang et al., 2017) N/A pGAG-Tet1 (Wang et al., 2017) N/A Tet1 catalytic domain mutant (Tet1-mCD) (Wang et al., 2017) N/A Tet1 catalytic domain (Tet1-CD) (Wang et al., 2017) N/A Software and Algorithms FlowJo 7.6 BD Biosciences https://www.flowjo.com/ Prism 6 GraphPad https://www.graphpad.com/ LinkedOmics (Vasaikar et al., 2018) http://www.linkedomics.org/ R2: Genomics Analysis and Visualization Platform Jan Koster https://hgserver1.amc.nl/cgi-bin/r2/main.cgi MethHC (Huang et al., 2015) http://methhc.mbc.nctu.edu.tw/ Kaplan-Meier Plotter (KM-Plotter) (Menyhárt et al., 2018) http://kmplot.com/analysis/ (Continued on next page) e2 Cell Metabolism 33, 1–18.e1–e5, January 5, 2021



    Similar Products

    94
    MedChemExpress 78c
    In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and <t>78c)</t> over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.
    78c, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd38+inhibitor+1/CD38+inhibitor+1/pmc13233800-43-0-2
    Average 94 stars, based on 1 article reviews
    78c - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    TargetMol compound 78c
    In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and <t>78c)</t> over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.
    Compound 78c, supplied by TargetMol, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd38+inhibitor+1/CD38+inhibitor+1/pmc13000301-348-0-19
    Average 94 stars, based on 1 article reviews
    compound 78c - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    MedChemExpress cd38 inhibitor
    <t>CD38</t> + CD8 + TILs predict ICB resistance (A–H) scRNA-seq of CD45 + immune cells from melanoma patients. (A) CD8 + T cell clusters ( n = 6,350). (B–D) Expression of (B) CD38 , (C) PD-1 ( PDCD1 ), and (D) TCF7 . (E) CD8 + T cell clusters by ICB response, (F) Proportion of CD38 expressing CD8 + T cells in ICB responders (ICB-R) and non-responders (ICB-NR). Two-sided unpaired t test. Means (bars) and individual values (open circles) are shown. (G and H) Receiver-operating characteristic (ROC) curves, demonstrating (G) the predictive power of CD38 + CD8 + TILs in melanoma tumors and (H) the specific performance of cluster 6 exhausted CD8 + T cells for ICB resistance. FPR, false-positive rate; TPR, true-positive rate. (I–L) scRNA-seq analysis of CD8 T cells from melanoma validation cohort. (I) Uniform manifold approximation and projection (UMAP) of CD8 T cells ( n = 20,210). (J) Proportion of CD38 expressing CD8 + T cells. Two-sided unpaired t test. Means (bars) and individual values (open circles) are shown. (K) CD38 expression and (L) TCF7 expression. (M) Proportion of CD38 expressing CD8 + T cells from NSCLC (MPR, major pathological response; ICB-R, n = 23, non-MPR; ICB-NR, n = 34, two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. (N) ROC curve demonstrating the predictive power of CD38 + CD8 + T cells for lack of ICB treatment benefit in NSCLC. See also and ; .
    Cd38 Inhibitor, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd38+inhibitor+1/CD38+inhibitor+1/pmc12281368-425-6-21
    Average 94 stars, based on 1 article reviews
    cd38 inhibitor - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    93
    Selleck Chemicals cd38 inhibitor 78c
    Characterization of <t>78c@Lipo-FA.</t> ( A ) Scheme diagram of the preparation process of Lipo-FA; materials including 78c, HPSC, cholesterol, octadecylamine, and DSPE-PEG2k-FA. ( B ) TEM of liposomes. ( C ) Particle size of liposomes ( n = 3). ( D ) Zeta potential of liposomes ( n = 3). ( E ) Representative panels of the uptaking-liposomes in the BMMs assayed by flow cytometry. ( F ) Representative images of the uptaking-liposomes in the BMMs observed by the fluorescence microscope (After BMMs were incubated for 4 h). ( G ) Relative fluorescence intensity of the uptake of liposomes by BMMs ( n = 3). *** p < 0.001
    Cd38 Inhibitor 78c, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd38+inhibitor+1/CD38+inhibitor+1/pmc12180219-40-1-7
    Average 93 stars, based on 1 article reviews
    cd38 inhibitor 78c - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and 78c) over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.

    Journal: iScience

    Article Title: Structural dissection of CD38 antigen engagement by CAR binders and rational affinity tuning

    doi: 10.1016/j.isci.2026.115937

    Figure Lengend Snippet: In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and 78c) over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.

    Article Snippet: 78c , MedChemExpress , Cat#HY-123999.

    Techniques: In Vitro, Inhibition, Activity Assay, Negative Control, Generated, Concentration Assay, Fluorescence

    CD38 + CD8 + TILs predict ICB resistance (A–H) scRNA-seq of CD45 + immune cells from melanoma patients. (A) CD8 + T cell clusters ( n = 6,350). (B–D) Expression of (B) CD38 , (C) PD-1 ( PDCD1 ), and (D) TCF7 . (E) CD8 + T cell clusters by ICB response, (F) Proportion of CD38 expressing CD8 + T cells in ICB responders (ICB-R) and non-responders (ICB-NR). Two-sided unpaired t test. Means (bars) and individual values (open circles) are shown. (G and H) Receiver-operating characteristic (ROC) curves, demonstrating (G) the predictive power of CD38 + CD8 + TILs in melanoma tumors and (H) the specific performance of cluster 6 exhausted CD8 + T cells for ICB resistance. FPR, false-positive rate; TPR, true-positive rate. (I–L) scRNA-seq analysis of CD8 T cells from melanoma validation cohort. (I) Uniform manifold approximation and projection (UMAP) of CD8 T cells ( n = 20,210). (J) Proportion of CD38 expressing CD8 + T cells. Two-sided unpaired t test. Means (bars) and individual values (open circles) are shown. (K) CD38 expression and (L) TCF7 expression. (M) Proportion of CD38 expressing CD8 + T cells from NSCLC (MPR, major pathological response; ICB-R, n = 23, non-MPR; ICB-NR, n = 34, two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. (N) ROC curve demonstrating the predictive power of CD38 + CD8 + T cells for lack of ICB treatment benefit in NSCLC. See also and ; .

    Journal: Cell Reports Medicine

    Article Title: Overcoming resistance to immunotherapy by targeting CD38 in human tumor explants

    doi: 10.1016/j.xcrm.2025.102210

    Figure Lengend Snippet: CD38 + CD8 + TILs predict ICB resistance (A–H) scRNA-seq of CD45 + immune cells from melanoma patients. (A) CD8 + T cell clusters ( n = 6,350). (B–D) Expression of (B) CD38 , (C) PD-1 ( PDCD1 ), and (D) TCF7 . (E) CD8 + T cell clusters by ICB response, (F) Proportion of CD38 expressing CD8 + T cells in ICB responders (ICB-R) and non-responders (ICB-NR). Two-sided unpaired t test. Means (bars) and individual values (open circles) are shown. (G and H) Receiver-operating characteristic (ROC) curves, demonstrating (G) the predictive power of CD38 + CD8 + TILs in melanoma tumors and (H) the specific performance of cluster 6 exhausted CD8 + T cells for ICB resistance. FPR, false-positive rate; TPR, true-positive rate. (I–L) scRNA-seq analysis of CD8 T cells from melanoma validation cohort. (I) Uniform manifold approximation and projection (UMAP) of CD8 T cells ( n = 20,210). (J) Proportion of CD38 expressing CD8 + T cells. Two-sided unpaired t test. Means (bars) and individual values (open circles) are shown. (K) CD38 expression and (L) TCF7 expression. (M) Proportion of CD38 expressing CD8 + T cells from NSCLC (MPR, major pathological response; ICB-R, n = 23, non-MPR; ICB-NR, n = 34, two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. (N) ROC curve demonstrating the predictive power of CD38 + CD8 + T cells for lack of ICB treatment benefit in NSCLC. See also and ; .

    Article Snippet: When indicated, cells were treated with CD38 inhibitor 1 μM 78c (6391, Tocris), IFNβ (Peprotech, 300-02BC), JAK inhibitor 1 μM ruxolitinib (MCE, HY-50858), nicotinamide riboside chloride (NR) at 100 or 500 μM (Sigma-Aldrich, SMB00907-50MG), or 1 nM of FK866 NAMPT inhibitor (Tocris, 4808).

    Techniques: Expressing, Biomarker Discovery

    Intratumoral CD38 + CD8 + T cells accumulate during tumor progression (A) scRNA-seq of T/NK cells from B16 tumors (Tum), tumor-draining lymph nodes (dLN), and normal lymph nodes (nLN). (B and C) Dotplots indicating (B) Cd38 expression and (C) Cd38 and Tcf7 expression at days 7, 10, and 16. (D–G) CyTOF analysis of CD38 + CD8 + T cells in peripheral blood from melanoma patients (D) by response to ICB; before (E) and after (F) ICB treatment. (G) CD8 + CD38 + IgG4 + by response to ICB. Two-sided unpaired t test. Means (bars) and individual values (open circles) are shown. (H–M) scRNA-seq of T/NK tumor-infiltrating leukocytes from control/IgG ( n = 3) and αPD-1 ( n = 4) B16-ova tumors. (H) UMAP of T/NK cell clusters by condition; (I and J) Cd38 expression and (K) proportion of Cd38 expressing terminal effector CD8 + TILs per condition. Two-sided unpaired t test. Median (line) and individual values (open circles) are shown. (L and M) UMAP and track plots showing Cd38 gene expression. Immune population statistics can be found in D. ∗ p < 0.05. See also and .

    Journal: Cell Reports Medicine

    Article Title: Overcoming resistance to immunotherapy by targeting CD38 in human tumor explants

    doi: 10.1016/j.xcrm.2025.102210

    Figure Lengend Snippet: Intratumoral CD38 + CD8 + T cells accumulate during tumor progression (A) scRNA-seq of T/NK cells from B16 tumors (Tum), tumor-draining lymph nodes (dLN), and normal lymph nodes (nLN). (B and C) Dotplots indicating (B) Cd38 expression and (C) Cd38 and Tcf7 expression at days 7, 10, and 16. (D–G) CyTOF analysis of CD38 + CD8 + T cells in peripheral blood from melanoma patients (D) by response to ICB; before (E) and after (F) ICB treatment. (G) CD8 + CD38 + IgG4 + by response to ICB. Two-sided unpaired t test. Means (bars) and individual values (open circles) are shown. (H–M) scRNA-seq of T/NK tumor-infiltrating leukocytes from control/IgG ( n = 3) and αPD-1 ( n = 4) B16-ova tumors. (H) UMAP of T/NK cell clusters by condition; (I and J) Cd38 expression and (K) proportion of Cd38 expressing terminal effector CD8 + TILs per condition. Two-sided unpaired t test. Median (line) and individual values (open circles) are shown. (L and M) UMAP and track plots showing Cd38 gene expression. Immune population statistics can be found in D. ∗ p < 0.05. See also and .

    Article Snippet: When indicated, cells were treated with CD38 inhibitor 1 μM 78c (6391, Tocris), IFNβ (Peprotech, 300-02BC), JAK inhibitor 1 μM ruxolitinib (MCE, HY-50858), nicotinamide riboside chloride (NR) at 100 or 500 μM (Sigma-Aldrich, SMB00907-50MG), or 1 nM of FK866 NAMPT inhibitor (Tocris, 4808).

    Techniques: Expressing, Control, Gene Expression

    CD38 hi CD8 + T cells are dysfunctional (A) Expression of exhaustion and effector/memory-related genes in CD8 + TILs from human melanoma tumors. (B) Co-expression deviation proportion plot demonstrating co-expression of exhaustion-related genes and TCF7 from melanoma validation cohort. (C and D) differentially expressed genes based on CD38 expression in (C) CD8 + TILs from human melanoma and (D) CD3 + TILs from B16-ova murine melanoma. (E and F) CD38 hi and CD38 lo B7-H3.CAR-T cells (E) surface staining of PD-1 + CD39 + TIM-3 + ( n = 3; two-sided paired t test) and (F) TCF7 expression ( n = 3; two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. (G) Scheme depicting acute and chronic TCR stimulation. (H–J) (H) Acute and chronic B7-H3.CAR-T proliferation assay ( n = 3; two-way ANOVA with Sidak correction for multiple comparisons). Means ± SEM (shaded area) are shown. Staining of (I) CD38 + CD39 + and (J) PD-1 + TIM-3 + ( n = 3, two-sided paired t test). Means (bars) and individual values (open circles) are shown. (K) Cytotoxicity assay toward 10164 patient-derived melanoma cell line. A representative experiment out of three is presented; two more are in E and S4F. ( n = 3 biological replicates; three independent experiments; two-way ANOVA with Sidak correction for multiple comparisons). Means ± SEM (shaded area) are shown. (L–N) Analysis of chronically stimulated control sgRNA and CD38 sgRNA B7-H3.CAR-T cells. (L) Proliferation assay ( n = 3 biological replicates; three independent experiments; two-way ANOVA with Sidak correction for multiple comparisons). Means ± SEM (shaded area) are shown. (M) TCF7 intracellular staining ( n = 4; two-sided paired t test). Means (bars) and individual values (open circles) are shown. (N) Cytotoxicity assay against 10164 melanoma cells ( n = 3 biological replicates; three independent experiments; two-way ANOVA with Sidak correction for multiple comparisons). Means ± SEM (shaded area) are shown. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗∗ p < 0.0001. See also ; and .

    Journal: Cell Reports Medicine

    Article Title: Overcoming resistance to immunotherapy by targeting CD38 in human tumor explants

    doi: 10.1016/j.xcrm.2025.102210

    Figure Lengend Snippet: CD38 hi CD8 + T cells are dysfunctional (A) Expression of exhaustion and effector/memory-related genes in CD8 + TILs from human melanoma tumors. (B) Co-expression deviation proportion plot demonstrating co-expression of exhaustion-related genes and TCF7 from melanoma validation cohort. (C and D) differentially expressed genes based on CD38 expression in (C) CD8 + TILs from human melanoma and (D) CD3 + TILs from B16-ova murine melanoma. (E and F) CD38 hi and CD38 lo B7-H3.CAR-T cells (E) surface staining of PD-1 + CD39 + TIM-3 + ( n = 3; two-sided paired t test) and (F) TCF7 expression ( n = 3; two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. (G) Scheme depicting acute and chronic TCR stimulation. (H–J) (H) Acute and chronic B7-H3.CAR-T proliferation assay ( n = 3; two-way ANOVA with Sidak correction for multiple comparisons). Means ± SEM (shaded area) are shown. Staining of (I) CD38 + CD39 + and (J) PD-1 + TIM-3 + ( n = 3, two-sided paired t test). Means (bars) and individual values (open circles) are shown. (K) Cytotoxicity assay toward 10164 patient-derived melanoma cell line. A representative experiment out of three is presented; two more are in E and S4F. ( n = 3 biological replicates; three independent experiments; two-way ANOVA with Sidak correction for multiple comparisons). Means ± SEM (shaded area) are shown. (L–N) Analysis of chronically stimulated control sgRNA and CD38 sgRNA B7-H3.CAR-T cells. (L) Proliferation assay ( n = 3 biological replicates; three independent experiments; two-way ANOVA with Sidak correction for multiple comparisons). Means ± SEM (shaded area) are shown. (M) TCF7 intracellular staining ( n = 4; two-sided paired t test). Means (bars) and individual values (open circles) are shown. (N) Cytotoxicity assay against 10164 melanoma cells ( n = 3 biological replicates; three independent experiments; two-way ANOVA with Sidak correction for multiple comparisons). Means ± SEM (shaded area) are shown. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗∗ p < 0.0001. See also ; and .

    Article Snippet: When indicated, cells were treated with CD38 inhibitor 1 μM 78c (6391, Tocris), IFNβ (Peprotech, 300-02BC), JAK inhibitor 1 μM ruxolitinib (MCE, HY-50858), nicotinamide riboside chloride (NR) at 100 or 500 μM (Sigma-Aldrich, SMB00907-50MG), or 1 nM of FK866 NAMPT inhibitor (Tocris, 4808).

    Techniques: Expressing, Biomarker Discovery, Staining, Proliferation Assay, Cytotoxicity Assay, Derivative Assay, Control

    CD38 + T cells exhibit altered bioenergetics (A) Correlation analysis between the GSEA of CD38 +/− CD8 + T cells in human melanoma and CD38 +/− CD3 + T cells in B16-ova murine melanoma. (B–E) Flow cytometry of (B and D) mitochondrial mass and (C and E) MMP in indicated groups ( n = 3; two-sided paired t test). Means (bars) and individual values (open circles) are shown. (F) Oxygen consumption rate (OCR) under basal condition and in response to inhibitors ( n = 5, two biological replicates, two-way ANOVA with Sidak correction for multiple comparisons). Data are presented as mean ± SEM. (G and H) Relative levels of (G) NAD + (nicotinamide adenine dinucleotide) and (H) NADP + (nicotinamide adenine dinucleotide phosphate); log 2 fold change (L2FC) from control is shown ( n = 6 biological replicates; two independent experiments; two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. (I) scheme of NAD + metabolism and L2FC of indicated analytes. (J) OCR as in (F) of B7-H3.CAR-T cells ± CD38i ( n = 5, two biological replicates, two-way ANOVA with Sidak correction for multiple comparisons). Data are presented as mean ± SEM. (K and L) staining of (K) TIM-3 + PD-1 + and (L) CD39 + TIM-3 + in B7-H3.CAR-T ± CD38i ( n ≥ 4; two-sided paired t test). Means (bars) and individual values (open circles) are shown. (M) TCF7 expression by RT-qPCR in B7-H3.CAR-T cells in indicated groups ( n = 4; two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. (N and O) Relative levels of (N) NAM (nicotinamide) and (O) ADPR (adenosine diphosphate ribose) in B7-H3.CAR-T cells ± CD38i ( n = 6 biological replicates; two independent experiments; two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. ∗ p < 0.05, ∗∗ p < 0.01. See also ; , , and .

    Journal: Cell Reports Medicine

    Article Title: Overcoming resistance to immunotherapy by targeting CD38 in human tumor explants

    doi: 10.1016/j.xcrm.2025.102210

    Figure Lengend Snippet: CD38 + T cells exhibit altered bioenergetics (A) Correlation analysis between the GSEA of CD38 +/− CD8 + T cells in human melanoma and CD38 +/− CD3 + T cells in B16-ova murine melanoma. (B–E) Flow cytometry of (B and D) mitochondrial mass and (C and E) MMP in indicated groups ( n = 3; two-sided paired t test). Means (bars) and individual values (open circles) are shown. (F) Oxygen consumption rate (OCR) under basal condition and in response to inhibitors ( n = 5, two biological replicates, two-way ANOVA with Sidak correction for multiple comparisons). Data are presented as mean ± SEM. (G and H) Relative levels of (G) NAD + (nicotinamide adenine dinucleotide) and (H) NADP + (nicotinamide adenine dinucleotide phosphate); log 2 fold change (L2FC) from control is shown ( n = 6 biological replicates; two independent experiments; two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. (I) scheme of NAD + metabolism and L2FC of indicated analytes. (J) OCR as in (F) of B7-H3.CAR-T cells ± CD38i ( n = 5, two biological replicates, two-way ANOVA with Sidak correction for multiple comparisons). Data are presented as mean ± SEM. (K and L) staining of (K) TIM-3 + PD-1 + and (L) CD39 + TIM-3 + in B7-H3.CAR-T ± CD38i ( n ≥ 4; two-sided paired t test). Means (bars) and individual values (open circles) are shown. (M) TCF7 expression by RT-qPCR in B7-H3.CAR-T cells in indicated groups ( n = 4; two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. (N and O) Relative levels of (N) NAM (nicotinamide) and (O) ADPR (adenosine diphosphate ribose) in B7-H3.CAR-T cells ± CD38i ( n = 6 biological replicates; two independent experiments; two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. ∗ p < 0.05, ∗∗ p < 0.01. See also ; , , and .

    Article Snippet: When indicated, cells were treated with CD38 inhibitor 1 μM 78c (6391, Tocris), IFNβ (Peprotech, 300-02BC), JAK inhibitor 1 μM ruxolitinib (MCE, HY-50858), nicotinamide riboside chloride (NR) at 100 or 500 μM (Sigma-Aldrich, SMB00907-50MG), or 1 nM of FK866 NAMPT inhibitor (Tocris, 4808).

    Techniques: Flow Cytometry, Control, Staining, Expressing, Quantitative RT-PCR

    Type I interferon induces CD38 expression in T cells (A and B) Expression of type I IFN-stimulated genes in CD8 + TILs from human melanoma (A) by cluster and (B) by response to ICB. (C–E) Staining of CD38 in human CD8 + TILs ( n = 3; in C, two-sided paired t test; in E, two-way ANOVA with Sidak correction for multiple comparisons). Means (bars) and individual values (open circles) are shown. (F) Analysis of relative NAD(H) in control or IFN-β-treated CD8 + TILs ( n = 3; two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. (G and H) staining of TIM-3 in CD8 + TILs in indicated groups ( n > 4; two-sided paired t test). (I and J) Flow-cytometry analysis of (I) MMP and (J) mitochondrial mass of CD8 + TILs ± IFN-β ( n = 3; two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. ∗ p < 0.05; ns, not significant. See also .

    Journal: Cell Reports Medicine

    Article Title: Overcoming resistance to immunotherapy by targeting CD38 in human tumor explants

    doi: 10.1016/j.xcrm.2025.102210

    Figure Lengend Snippet: Type I interferon induces CD38 expression in T cells (A and B) Expression of type I IFN-stimulated genes in CD8 + TILs from human melanoma (A) by cluster and (B) by response to ICB. (C–E) Staining of CD38 in human CD8 + TILs ( n = 3; in C, two-sided paired t test; in E, two-way ANOVA with Sidak correction for multiple comparisons). Means (bars) and individual values (open circles) are shown. (F) Analysis of relative NAD(H) in control or IFN-β-treated CD8 + TILs ( n = 3; two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. (G and H) staining of TIM-3 in CD8 + TILs in indicated groups ( n > 4; two-sided paired t test). (I and J) Flow-cytometry analysis of (I) MMP and (J) mitochondrial mass of CD8 + TILs ± IFN-β ( n = 3; two-sided unpaired t test). Means (bars) and individual values (open circles) are shown. ∗ p < 0.05; ns, not significant. See also .

    Article Snippet: When indicated, cells were treated with CD38 inhibitor 1 μM 78c (6391, Tocris), IFNβ (Peprotech, 300-02BC), JAK inhibitor 1 μM ruxolitinib (MCE, HY-50858), nicotinamide riboside chloride (NR) at 100 or 500 μM (Sigma-Aldrich, SMB00907-50MG), or 1 nM of FK866 NAMPT inhibitor (Tocris, 4808).

    Techniques: Expressing, Staining, Control, Flow Cytometry

    CD38 blockade overcomes ICB resistance (A) Scheme of PDOTS preparation. (B) Viability assessment of melanoma PDOTS ( n = 27) following treatment with anti-PD-1 (pembrolizumab), anti-CD38 (daratumumab), or the combination. Individual values (open circles) indicate the mean for each PDOTS specimen; one-way ANOVA with Greenhouse-Geisser correction for multiple comparisons. (C) Waterfall plot of melanoma PDOTS ( n = 27). Response is defined as a 30% reduction from control (lower dashed lines); growth is defined as a 20% increase from control (upper dashed lines). Viability percentages of controls are in . (D and E) PDOTS viability assessment with indicated treatments ( n = 3 biological replicates per PDOTS specimen, one-way ANOVA with Tukey correction for multiple comparisons). Means (bars) and individual values (open circles) are shown. (F) Representative images of PDOTS in (E). HO, Hoechst (blue); PI, propidium iodide (dead cells [red]). Scale bars, 100 μm. (G) scRNA-seq analysis of CD8 + T cells ( n = 39,621) from tumors in (B) and (C) ( n = 21), showing CD38 expression. (H) CD38 expression in indicated clusters ( n = 21, one-way ANOVA with Tukey correction for multiple comparisons). (I) GSEA of CD38 + PD-1 blockade responding tumors in Prolif.CD8 and CXCL13 + T cell clusters ( n = 12). (J) Module score of IFNG and GZMA in Prolif.CD8 and CXCL13 + T cells discriminate PDOTS responsive (R) and non-responsive (NR) to dual PD-1/CD38 blockade (R, n = 12; NR, n = 8; individual graphs are in H and S11I). (K and L) Viability assessment of (K) B16-ova MDOTS ( n = 6 biological replicates, two independent experiments) and (L) CT26-GFP MDOTS treated with indicated treatments ( n = 12 biological replicates, four independent experiments, one-way ANOVA with Tukey correction for multiple comparisons). Means (bars) and individual values (open circles) are shown. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; ns, not significant. See also ; , , , and .

    Journal: Cell Reports Medicine

    Article Title: Overcoming resistance to immunotherapy by targeting CD38 in human tumor explants

    doi: 10.1016/j.xcrm.2025.102210

    Figure Lengend Snippet: CD38 blockade overcomes ICB resistance (A) Scheme of PDOTS preparation. (B) Viability assessment of melanoma PDOTS ( n = 27) following treatment with anti-PD-1 (pembrolizumab), anti-CD38 (daratumumab), or the combination. Individual values (open circles) indicate the mean for each PDOTS specimen; one-way ANOVA with Greenhouse-Geisser correction for multiple comparisons. (C) Waterfall plot of melanoma PDOTS ( n = 27). Response is defined as a 30% reduction from control (lower dashed lines); growth is defined as a 20% increase from control (upper dashed lines). Viability percentages of controls are in . (D and E) PDOTS viability assessment with indicated treatments ( n = 3 biological replicates per PDOTS specimen, one-way ANOVA with Tukey correction for multiple comparisons). Means (bars) and individual values (open circles) are shown. (F) Representative images of PDOTS in (E). HO, Hoechst (blue); PI, propidium iodide (dead cells [red]). Scale bars, 100 μm. (G) scRNA-seq analysis of CD8 + T cells ( n = 39,621) from tumors in (B) and (C) ( n = 21), showing CD38 expression. (H) CD38 expression in indicated clusters ( n = 21, one-way ANOVA with Tukey correction for multiple comparisons). (I) GSEA of CD38 + PD-1 blockade responding tumors in Prolif.CD8 and CXCL13 + T cell clusters ( n = 12). (J) Module score of IFNG and GZMA in Prolif.CD8 and CXCL13 + T cells discriminate PDOTS responsive (R) and non-responsive (NR) to dual PD-1/CD38 blockade (R, n = 12; NR, n = 8; individual graphs are in H and S11I). (K and L) Viability assessment of (K) B16-ova MDOTS ( n = 6 biological replicates, two independent experiments) and (L) CT26-GFP MDOTS treated with indicated treatments ( n = 12 biological replicates, four independent experiments, one-way ANOVA with Tukey correction for multiple comparisons). Means (bars) and individual values (open circles) are shown. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; ns, not significant. See also ; , , , and .

    Article Snippet: When indicated, cells were treated with CD38 inhibitor 1 μM 78c (6391, Tocris), IFNβ (Peprotech, 300-02BC), JAK inhibitor 1 μM ruxolitinib (MCE, HY-50858), nicotinamide riboside chloride (NR) at 100 or 500 μM (Sigma-Aldrich, SMB00907-50MG), or 1 nM of FK866 NAMPT inhibitor (Tocris, 4808).

    Techniques: Control, Expressing

    Disrupting CD38 restores NAD + and overcomes ICB resistance (A and B) Viability assessment of (A) B16-ova MDOTS ( n = 6 biological replicates, two independent experiments) and (B) CT26-GFP MDOTS ( n = 12 biological replicates, four independent experiments). One-way ANOVA with Tukey correction for multiple comparisons. Means (bars) and individual values (open circles) are shown. (C) Representative images of MDOTS in (B). HO, Hoechst (blue); PI, propidium iodide (dead cells [red]); tumor, GFP-tumor cells. (D) Viability assessment of CT26-GFP MDOTS with indicated treatments ( n = 6 biological replicates, two independent experiments, one-way ANOVA with Tukey correction for multiple comparisons). Means (bars) and individual values (open circles) are shown. (E) Viability assessment of melanoma PDOTS with indicated treatments. ( n = 18, six independent specimens; mixed-effects one-way ANOVA with Tukey correction for multiple comparisons). (F) Viability assessment of melanoma PDOTS treated with indicated treatments ( n = 3 biological replicates; one-way ANOVA with Tukey correction for multiple comparisons). Means (bars) and individual values (open circles) are shown. (G) Scheme demonstrating the effect of targeting CD38 in T cells by increasing NAD + and TCF7 expression along with restoring mitochondrial function and overcoming resistance to ICB. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; ns, not significant. See also and .

    Journal: Cell Reports Medicine

    Article Title: Overcoming resistance to immunotherapy by targeting CD38 in human tumor explants

    doi: 10.1016/j.xcrm.2025.102210

    Figure Lengend Snippet: Disrupting CD38 restores NAD + and overcomes ICB resistance (A and B) Viability assessment of (A) B16-ova MDOTS ( n = 6 biological replicates, two independent experiments) and (B) CT26-GFP MDOTS ( n = 12 biological replicates, four independent experiments). One-way ANOVA with Tukey correction for multiple comparisons. Means (bars) and individual values (open circles) are shown. (C) Representative images of MDOTS in (B). HO, Hoechst (blue); PI, propidium iodide (dead cells [red]); tumor, GFP-tumor cells. (D) Viability assessment of CT26-GFP MDOTS with indicated treatments ( n = 6 biological replicates, two independent experiments, one-way ANOVA with Tukey correction for multiple comparisons). Means (bars) and individual values (open circles) are shown. (E) Viability assessment of melanoma PDOTS with indicated treatments. ( n = 18, six independent specimens; mixed-effects one-way ANOVA with Tukey correction for multiple comparisons). (F) Viability assessment of melanoma PDOTS treated with indicated treatments ( n = 3 biological replicates; one-way ANOVA with Tukey correction for multiple comparisons). Means (bars) and individual values (open circles) are shown. (G) Scheme demonstrating the effect of targeting CD38 in T cells by increasing NAD + and TCF7 expression along with restoring mitochondrial function and overcoming resistance to ICB. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; ns, not significant. See also and .

    Article Snippet: When indicated, cells were treated with CD38 inhibitor 1 μM 78c (6391, Tocris), IFNβ (Peprotech, 300-02BC), JAK inhibitor 1 μM ruxolitinib (MCE, HY-50858), nicotinamide riboside chloride (NR) at 100 or 500 μM (Sigma-Aldrich, SMB00907-50MG), or 1 nM of FK866 NAMPT inhibitor (Tocris, 4808).

    Techniques: Expressing

    Characterization of 78c@Lipo-FA. ( A ) Scheme diagram of the preparation process of Lipo-FA; materials including 78c, HPSC, cholesterol, octadecylamine, and DSPE-PEG2k-FA. ( B ) TEM of liposomes. ( C ) Particle size of liposomes ( n = 3). ( D ) Zeta potential of liposomes ( n = 3). ( E ) Representative panels of the uptaking-liposomes in the BMMs assayed by flow cytometry. ( F ) Representative images of the uptaking-liposomes in the BMMs observed by the fluorescence microscope (After BMMs were incubated for 4 h). ( G ) Relative fluorescence intensity of the uptake of liposomes by BMMs ( n = 3). *** p < 0.001

    Journal: Journal of Nanobiotechnology

    Article Title: Bionic bearing-inspired lubricating microspheres with Immunomodulatory effects for osteoarthritis therapy

    doi: 10.1186/s12951-025-03544-2

    Figure Lengend Snippet: Characterization of 78c@Lipo-FA. ( A ) Scheme diagram of the preparation process of Lipo-FA; materials including 78c, HPSC, cholesterol, octadecylamine, and DSPE-PEG2k-FA. ( B ) TEM of liposomes. ( C ) Particle size of liposomes ( n = 3). ( D ) Zeta potential of liposomes ( n = 3). ( E ) Representative panels of the uptaking-liposomes in the BMMs assayed by flow cytometry. ( F ) Representative images of the uptaking-liposomes in the BMMs observed by the fluorescence microscope (After BMMs were incubated for 4 h). ( G ) Relative fluorescence intensity of the uptake of liposomes by BMMs ( n = 3). *** p < 0.001

    Article Snippet: The CD38 inhibitor (78c) was purchased from Selleck (Wuhan, China).

    Techniques: Liposomes, Zeta Potential Analyzer, Flow Cytometry, Fluorescence, Microscopy, Incubation